feng zhang (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
feng zhang
Feng Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 357 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dcas-vp64_blast/lenti+dCAS-VP64_Blast+(Plasmid+%2361425)/pm41856116-938-14-16
Average 96 stars, based on 357 article reviews
Feng Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 357 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dcas-vp64_blast/lenti+dCAS-VP64_Blast+(Plasmid+%2361425)/pm41856116-938-14-16
Average 96 stars, based on 357 article reviews
feng zhang - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: SHMT2 deficiency disrupts transcriptional regulation through homocysteine-mediated suppression of histone lactylation in Huntington's disease models. Article Snippet: .. The dCas9-KRAB repressor was expressed from a lentiviral vector derived from Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. Lenti dCAS-VP64_Blast, lenti MS2-P65-HSF1_Hygro, lentiGuide-Puro, lenti sgRNA (MS2) puro backbone were a gift from Article Title: A Genetically Engineered Human Organoid Model Reveals Distinct Genetic and Epigenetic Barriers of Lineage Plasticity in Early PDAC Transformation Article Snippet: The U6-sgRNA entry expression cassettes from pPGKenCh- CDKN2A Cr or pPGKenCh- TP53 Cr were transferred into pWPXL-Hygro(DEST) using LR clonase (Invitrogen) to create iKO- CDKN2A Cr and iKO- TP53 Cr sgRNA expression plasmids. iKO- CDKN2A Cr was digested with AscI, 5’ overhangs were removed with Mung Bean Nuclease and the PCR amplified U6- TP53 Cr-tracr cassette from iKO- TP53 Cr vector was cloned downstream of the U6- CDKN2A Cr expression cassette to create iKO- CDKN2A Cr- TP53 Cr sgRNA expression plasmid. .. To deliver AP-1 specific sgRNA into KCP POs, a lentiGuide-Blast sgRNA expression vector was constructed by replacing the puromycin resistance cassette of lentiGuide-Puro vector (Addgene #52963) with a Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. First, we aimed to substitute the endogenous Cas9 cassette by targeting the Cas9 protein to the Cas9 DNA flanking regions either with a dCas9-VP64 donor sequence from Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. The resulting average methylation percentages per region were obtained and compared for the WT, TET1 KO, QSER1 KO and TET1/QSER1 double KO conditions. e10 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS CRISPRa CCR targeting in QSER1/TET1-KO line 2 × 105 TET1/QSER1-DKO hESCs (DKO) and their corresponding WT matching line were transduced with the lentiviral supernatant generated from the Derivative Assay:Article Title: SHMT2 deficiency disrupts transcriptional regulation through homocysteine-mediated suppression of histone lactylation in Huntington's disease models. Article Snippet: .. The dCas9-KRAB repressor was expressed from a lentiviral vector derived from Clone Assay:Article Title: SHMT2 deficiency disrupts transcriptional regulation through homocysteine-mediated suppression of histone lactylation in Huntington's disease models. Article Snippet: .. The dCas9-KRAB repressor was expressed from a lentiviral vector derived from Generated:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. Lenti dCAS-VP64_Blast, lenti MS2-P65-HSF1_Hygro, lentiGuide-Puro, lenti sgRNA (MS2) puro backbone were a gift from Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. The resulting average methylation percentages per region were obtained and compared for the WT, TET1 KO, QSER1 KO and TET1/QSER1 double KO conditions. e10 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS CRISPRa CCR targeting in QSER1/TET1-KO line 2 × 105 TET1/QSER1-DKO hESCs (DKO) and their corresponding WT matching line were transduced with the lentiviral supernatant generated from the Expressing:Article Title: A Genetically Engineered Human Organoid Model Reveals Distinct Genetic and Epigenetic Barriers of Lineage Plasticity in Early PDAC Transformation Article Snippet: The U6-sgRNA entry expression cassettes from pPGKenCh- CDKN2A Cr or pPGKenCh- TP53 Cr were transferred into pWPXL-Hygro(DEST) using LR clonase (Invitrogen) to create iKO- CDKN2A Cr and iKO- TP53 Cr sgRNA expression plasmids. iKO- CDKN2A Cr was digested with AscI, 5’ overhangs were removed with Mung Bean Nuclease and the PCR amplified U6- TP53 Cr-tracr cassette from iKO- TP53 Cr vector was cloned downstream of the U6- CDKN2A Cr expression cassette to create iKO- CDKN2A Cr- TP53 Cr sgRNA expression plasmid. .. To deliver AP-1 specific sgRNA into KCP POs, a lentiGuide-Blast sgRNA expression vector was constructed by replacing the puromycin resistance cassette of lentiGuide-Puro vector (Addgene #52963) with a Construct:Article Title: A Genetically Engineered Human Organoid Model Reveals Distinct Genetic and Epigenetic Barriers of Lineage Plasticity in Early PDAC Transformation Article Snippet: The U6-sgRNA entry expression cassettes from pPGKenCh- CDKN2A Cr or pPGKenCh- TP53 Cr were transferred into pWPXL-Hygro(DEST) using LR clonase (Invitrogen) to create iKO- CDKN2A Cr and iKO- TP53 Cr sgRNA expression plasmids. iKO- CDKN2A Cr was digested with AscI, 5’ overhangs were removed with Mung Bean Nuclease and the PCR amplified U6- TP53 Cr-tracr cassette from iKO- TP53 Cr vector was cloned downstream of the U6- CDKN2A Cr expression cassette to create iKO- CDKN2A Cr- TP53 Cr sgRNA expression plasmid. .. To deliver AP-1 specific sgRNA into KCP POs, a lentiGuide-Blast sgRNA expression vector was constructed by replacing the puromycin resistance cassette of lentiGuide-Puro vector (Addgene #52963) with a Cloning:Article Title: A Genetically Engineered Human Organoid Model Reveals Distinct Genetic and Epigenetic Barriers of Lineage Plasticity in Early PDAC Transformation Article Snippet: The U6-sgRNA entry expression cassettes from pPGKenCh- CDKN2A Cr or pPGKenCh- TP53 Cr were transferred into pWPXL-Hygro(DEST) using LR clonase (Invitrogen) to create iKO- CDKN2A Cr and iKO- TP53 Cr sgRNA expression plasmids. iKO- CDKN2A Cr was digested with AscI, 5’ overhangs were removed with Mung Bean Nuclease and the PCR amplified U6- TP53 Cr-tracr cassette from iKO- TP53 Cr vector was cloned downstream of the U6- CDKN2A Cr expression cassette to create iKO- CDKN2A Cr- TP53 Cr sgRNA expression plasmid. .. To deliver AP-1 specific sgRNA into KCP POs, a lentiGuide-Blast sgRNA expression vector was constructed by replacing the puromycin resistance cassette of lentiGuide-Puro vector (Addgene #52963) with a Sequencing:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. First, we aimed to substitute the endogenous Cas9 cassette by targeting the Cas9 protein to the Cas9 DNA flanking regions either with a dCas9-VP64 donor sequence from Single Cell:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and Recombinant:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and Software:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and Chromatin Immunoprecipitation:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and Magnetic Cell Separation:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and Methylation:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. The resulting average methylation percentages per region were obtained and compared for the WT, TET1 KO, QSER1 KO and TET1/QSER1 double KO conditions. e10 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS CRISPRa CCR targeting in QSER1/TET1-KO line 2 × 105 TET1/QSER1-DKO hESCs (DKO) and their corresponding WT matching line were transduced with the lentiviral supernatant generated from the Transduction:Article Title: Functional chromatin signatures premark future lineage-specific enhancers. Article Snippet: .. The resulting average methylation percentages per region were obtained and compared for the WT, TET1 KO, QSER1 KO and TET1/QSER1 double KO conditions. e10 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS CRISPRa CCR targeting in QSER1/TET1-KO line 2 × 105 TET1/QSER1-DKO hESCs (DKO) and their corresponding WT matching line were transduced with the lentiviral supernatant generated from the |